Recopilación de entradas sobre escritura

En esta entrada voy a hacer un recopilatorio de las entradas que llevo por el momento sobre mi particular Taller Literario para Pobres, en la etiqueta están la mayoría de entradas, excepto algún recurso que se me ha quedado suelto. Además,como las entradas no están precisamente planificadas en orden (suelo escribir lo que me preocupa en ese momento), he añadido organizarlas en más categorías:

Entradas sobre…

Como ya he explicado alguna vez, no soy profesional, y con estas entradas busco tanto hacer un ejercicio de auto-análisis como ayudar a los que pueden estar en la misma situación que yo.

Construir buenos entornos

Cuando estamos intentado escribir un texto de ficción lo normalmente planificamos mejor son dos cosas: el argumento y los personajes.

Sin embargo, hay otro aspecto que puede dar mucha vida a nuestras historias: los lugares donde estas se desarrollan.

Colinas de Chocolate Filipinas
Colinas de Chocolate. Colinas. de. Chocolate. (Per Andre Hoffman)

El entorno ayuda a ambientar la historia, puede influir en las emociones que queremos transmitir, puede dar profundidad, puede hacerla más rica y variada, e, incluso, puede acabar siendo protagonista de la historia.

No era algo sobre lo que me comía demasiado la cabeza hasta hacer relativamente poco, como si el ambiente no fuera más que el fondo de pantalla de la historia. Y aún así, no hay más que leer cualquier novela medio buena que haya por casa para ver lo mucho que el entorno puede usarse como una parte dinámica más de la historia: con su propio transfondo, carácter y utilidad.

El entorno puede influir en el argumento, los personajes pueden relacionarse con el mismo como si fuera otro personaje más. Creo que darle un entorno adecuado a nuestra historia es otro importante elemento a tener en cuenta a la hora de desarrollarla. Veamos:

 

Jaime miró el reloj, esperando la hora de volver a casa mientras sorbía de su fría taza de café en su oficina.

Jaime miró el reloj, esperando la hora de volver a casa mientras sorbía de su fría taza de café en la Luna.

¿Qué tal?

¿Que por qué está ese tipo en la Luna? No tengo ni idea, ahí está la gracia. Ahora puedo crear una historia alrededor de que hay un tipo bebiendo café en la Luna, los lectores con un poco de suerte también quedarán intrigados, querrán saber qué está pasando (recuerdo lo que comentaba sobre los ganchos en las historias). Solo he cambiado el entorno en el que está el personaje, y la historia de una sola frase ya ha dado un giro brutal.

Ahora bien, el entorno tiene principalmente dos peligros para los escritores:

  • Que no encaje bien con la historia: por muy interesante que sea el lugar, el castillo de Barba Azul no creo que sea el mejor sitio para una bonita comedia romántica.
  • Que no esté bien integrado en la historia: si la narrativa no reclama un entorno no es necesario meterlo a la fuerza. También está el riesgo omnipresente de enrollarse con descripciones, son muy escasos los escritores con la maravillosa habilidad de hacer largas descripciones de paisajes sin aburrir al personal (menos del 0’5% de los que se creen que pueden hacerlo), el lugar más fascinante del mundo puede quedar chafado si los lectores se quedan groguis con nuestra narración. Hay que hilvanar el entorno con los personajes y el argumento, no meterlo a bofetadas.

Muchas veces el entorno ya lo tenemos por defecto, se nos ocurrió mientras creábamos la historia, así que lo que nos queda es, sencillamente, pulirlo, intentar sacarle el mejor partido, estudiar las mejores maneras de fundirlo con el resto del argumento, etc.

Otras veces, como podría ser en una historia de fantasía o ciencia ficción, podemos hacer lo que nos de la gana con el entorno. Podemos crearlo de cero. Las posibilidades son infinitas.

Por el momento, he creado esta clasificación (carente de orden, es un primer borrador según voy estudiando), de diferentes tipos o… «apariencias» para trabajar con los entornos de nuestras historias:

  • Distancias: el entorno puede ser algo que esté lejos, como un satélite, un horizonte, una lejana cordillera de blancos picos… O puede ser algo muy cercano: una habitación, el camino por el que se anda, un vehículo, etc. El entorno lejano puede usarse para dar ambientillo, para crear amenazas en la lontananza, la representación de un futuro incierto, también suele ser pasivo. El entorno más cercano es el ahora, es inmediato y requiere la atención activa tanto del lector como de los personajes.
  • Objetos concretos: la torre de Pisa, un árbol sagrado, un volcán, etc. Un solo objeto, o grupos de objetos, define todo el entorno.
  • La naturaleza tiene sentimientos (muy bien, no sabía como nombrar este punto, ¿vale?): es el recurso más viejo del mundo; usar el clima, la luminosidad, el ruido del entorno…, como metáfora de lo que ocurre en la historia y los sentimientos, y hasta el carácter, de los personajes. Puedes usarlo hasta como título de la novela y todo (Cumbres Borrascosas, ¿hola?).
  • Los objetos pueden ser activos: aunque el entorno, normalmente y en apariencia, sea algo quieto y pasivo (quitando fenómenos atmosféricos), puede meterse de forma activa en la historia, como esa raíz que hace tropezar al héroe, esos molinos contra los que va a ostirase Don Quijote, etc.
  • Lugares extraordinarios: lugares exóticos, misteriosos, ocultos, siniestros… Hay sitios que con solo mencionarlos ya forman vívidas imágenes mentales en nuestras cabezas (cementerio, Hawaii), otros son aún más extravagantes y necesitan de mayores explicaciones (véase imagen superior: colinas de chocolate, no, no me lo he inventado, hay un sitio llamado así).

Estás son algunas de las maneras en las que podemos presentar nuestro entorno en la historia. Como he mencionado arriba, igual hallar el sitio perfecto para que ese duelo a cuchillo al amanecer sea vívido y emocionante puede ser fácil (?), lo difícil es lograr sacarle todo el partido que podamos sin convertirlo en una carga que empañe el trabajo que ya tenemos hecho.

Y aquí es donde yo ya no tengo más ideas, habrá que seguir escribiendo, a ver qué sale 🙂

Construir personajes de ficción

Ya ha hablado antes sobre cómo crear personajes interesantes en una novela (sí, sigue siendo de la misma serie de entradas sobre cómo escribir novelas, es que no me apetece poner el título, que es muy largo, se puede serguir por las etiquetas).

He leído varias páginas con recursos sobre lo que es la mecánica de construir un personaje desde cero, y hay una técnica que se repite mucho: la ficha del personaje; con todos los datos que se nos ocurran: nombre, descripción física, transfondo, relaciones, intereses, valores, virtudes, defectos, características particulares, etc.

La idea de hacer un personaje muy detallado es que hace que sea más humano y, por tanto, más creíble y, por tanto, más fácil de empatizar y, por tanto, más fácil de hacer que los lectores se queden pegados a las páginas del libro. Por eso hay quien recomienda incluir cosas como su color favorito, su música preferida, en qué le gusta pasar las aburridas mañanas de domingo y un montón de datos diversos más que ni siquiera van a aparecer en la historia.

Seguir leyendo “Construir personajes de ficción”

Guía Rápida para Escribir una Novela

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma al primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :).

 

Cómo escribir novelas sin dinero: El Estilo 2

Continuando con mi maravillosa saga sobre cómo aprender a escribir novelas aprovechándome gratis de los recursos de la red y divagando como si no hubiera mañana (y, a veces, hasta las escribo). Aquí están las entradas anteriores.

En esta continuo un poco con el tema del estilo. En la primera entrada hablé del estilo en general, referido a la claridad de la narración, la organización, el orden de las ideas y las plabras para dar mayor expresividad y fuerza a la historia, etc.

Ahora me voy a meter un poco con detalles más concretos, como son las frases y las palabras en sí mismas.

Clichés no, gracias, debes dejarlos crecer

A menudo el cliché se emplea para referirse a técnicas o argumentos usados hasta el punto del abuso. Lo malo de los clichés no es que lo que ocurre está mal, si no que se ha hecho tantas veces que es predecible y aburrido.

Por otro lado, he aprendido que en el estilo los clichés también son frases hechas o expresiones repetitivas, que en el mundo normal se emplean mucho (y probablemente, hasta en cientos de libros que hayamos leído), pero que cuando queremos escribir una novela debemos evitar. ¿Por qué? Pues porque como en los clichés argumentales, carecen de fuerza e interés, no atrapan al lector (que es el principal objetivo de un novelista que quiera pa’ comé). A veces hasta son ridículos.

Seguir leyendo “Cómo escribir novelas sin dinero: El Estilo 2”

Cómo escribir novelas sin dinero: Los malos

Está entrada va a ser sólo una pequeña reflexión inspirada en una historia que he estado leyendo antes.

Cuando hablaba de construir personajes literarios mencioné a las Mary Sues y lo importante que es que nuestros personajes tengan defectos, y no hablé mucho del caso contrario: un personaje que es todo defectos.

Normalmente estos personajes encajan con esa idea de malos malosos de la Disney, que son malos porque sí y más simples que el diseño de un Chupa-Chups. Así que como para hacer personajes “buenos” (o, al menos, interesantes y creíbles), es importante que tengan defectos; al contrario, para hacer personajes malos, es importante que estos tengan alguna cualidad, ¿no es así?

Lo he estado pensando y me he dado cuenta que hasta cierto punto es cierto, pero me acordé de que una vez alguien criticó al malo de El Laberinto del Minotauro porque era demasiado malo y, por tanto, no creíble.

Me resultó un tanto absurdo, ya que es un personaje bastante interesante y bien hecho, hay gente así de monstruosa por el mundo, así que ¿se pueden hacer personajes irremediablemente malvados y repugnantes y aún así conseguir que sean interesantes? y, si es posible, ¿se puede hacer lo mismo con los “buenos”?

¿Cómo?

Yo tengo una pequeña idea, no es una idea de aplicación directa o que intente resolver completamente toda esta cuestión, pero creo que es importante a la hora de construir personajes que estos sean débiles. La debilidad los hace humanos, y hacerlos humanos los hace creíbles, cercanos e interesantes.

No me refiero a debilidad sólo física, o a que continuamente se muestren así, el malo del Laberinto no era débil en absoluto, su personaje precisamente se basa en ser como un trozo de granito, al menos a simple vista, pero en su forma de tratarlo se nos muestra (o, más bien, se nos insinúa) cierto transfondo respecto a la historia de él con su padre, cierto temor a los maquis, en una escena hacia al final aparece cortándose mientras se afeita, etc. Esto le da cierta debilidad, ciertas muescas en la coraza.

Otro ejemplo, después de ver la película de V de Vendetta estuve escuchando a un friki (lol frikiz, inrite?) quejándose de lo horrible que era en comparación al cómic. A mí, personalmente, hubo muchas aspectos de la película que me gustaron más que el cómic. Uno de ellos fue precisamente que hicieron humano a V. En el cómic V está endiosado como woa, probablemente es un punto del libro que V sea ~una idea~, está bien, es un recurso aceptable, pero yo personalmente no leo cómics de ficción sólo para leer ideas, yo quiero personajes.

En la película hay una escena en la que V le está poniendo comida a Eve, ésta comenta algo sobre sus manos y V corre a tapárselas de nuevo. Zing. ¿Lo habéis visto? Ahí está. En una escena de segundos V ha pasado de ser una idea a ser humano. Dentro del disfraz hay un humano herido, posiblemente desfigurado y débil, en el fondo. Para mí, el V de la película le da mil patadas el V del cómic, es millones de veces más interesante, quiero saber qué paso con él. El V del cómic me la repatea y es Eve la que tira del interés de prácticamente toda la historia (claro, es “débil”).

¿Qué opináis?, ¿se me va la pinza?, ¿se os ocurre otras formas de dar interés a un personaje?, ¿creéis que mi interpretación de V es absolutamente errónea y no he entendido nada de lo que el Gran Moore quería decir?, ¿alguien sabe cómo hacer que el pesado de mi perro le deje de ladrar al viento?

Off-topic: Nunca he querido poner publicidad en la web, pero estoy tan apurada que lo estoy pensando, aunque dudo que consiga nada, pero si en un año me da para pagar la mitad de lo que me cuesta el dominio me doy con un canto en los dientes, ¿qué os parece?

Cómo escribir novelas sin dinero: El Estilo 1

Continuando con mi apasionante saga sobre desde El Argumento y Los Personajes.

De entre todos los factores que afectan a una buena narrativa de ficción probablemente el que más me preocupa es el estilo. De todos los demás me considero capaz de hacerlo bien o mejorar si trabajo y presto atención a lo que estoy haciendo. Pero, ¿cómo narices mejora una su estilo?

No me estoy refiriendo al estilo técnico de dónde pongo esta coma, por aquí debería haber un punto y aparte o qué guión se usa en los diálogos (raya, no tenía ni idea, i fail); o si es directo o indirecto.

Estoy hablando de la manera de ordenar ideas, escoger palabras, presentar acciones… básicamente todo lo que consiga llevar nuestra historia al lector en el vehículo más simple, bonito, emocionante y/o realista posible.

Algunos lo llaman “voz“, pero aunque está relacionado, y a menudo es lo mismo, yo uso “voz” para algo más concreto; por ejemplo, cada personaje creo que debería tener su “voz”, pero las “voces” siempre entran dentro del más amplio estilo del autor (¿igual podemos hablar de microvoz y macrovoz?).

He intentado crearme algunas guías al respecto, pero este es un punto que no sólo los blogs en inglés me fallan, porque, para empezar, están en inglés y las diferencias con el castellano hacen que reutilizar determinadas estrategias en un idioma no sirva en castellano; también porque no hay demasiada información, el estilo personal y la voz son un limbo que muchos intentan entender y que es casi imposible de enseñar. Esto es más o menos lo que he ido sacando a grandes rasgos:

Seguir leyendo “Cómo escribir novelas sin dinero: El Estilo 1”