Guía Rápida para Escribir una Novela

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma al primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :).

 

13 comentarios en “Guía Rápida para Escribir una Novela

  1. Ola.

    Recientemente he decidido retomar una novela que empece a escribir hace un tiempo y quisiera algo de ayuda. En teoría, tengo mis personajes creados, pero inanimados, tengo un argumento poco argumentado y básicamente, me pregunto, ¿qué piensas tú?, (Que has escrito tan buenos aportes) para retomar mi historia, ¿debo enfocarme primero en mis personajes y darles vida, o en el argumento, y hacer asi como, diseñar y construir la casa y luego poner un anuncio de “se busca, personaje serio y de buenos modales, para habitar esta, que más que una casa es toda una historia”?
    Usualmente me llevo del antropocentrismo, pero, la verdad, me gusta analizar la forma de pensar de cada quien para aprender algo nuevo.

    Me gusto este último aporte 🙂

    Saludos,

    1. @Roy, primero, muchas gracias por comentar, me alegro que mis aportes sean de utilidad para alguien 😀

      Sobre la pregunta, dependerá de tus preferencias, aunque si se te da bien construir personajes, igual conviene pensarse más la trama y viceversa. Me explico:
      Como ya he mencionado, no soy mucho de planificar, a menudo no tengo nada más que una idea con algunas escenas que me gustaría acometer y un posible final; normalmente doy prioridad a los personajes en el desarrollo, creo que se me dan bien e igual por eso no pierdo mucho el tiempo definiéndolos, con una idea base de cómo son y lo que quieren me basta para empezar.
      Así que con eso sencillamente me siento y escribo, a ver lo que surge.
      A la larga, lo que termino por retocar más es el argumento, por eso ahora intento aprender a planificarlo mejor antes de escribir, me ahorra correcciones xD
      Pero si es un problema de bloqueo, no sabes qué escribir, empieza por lo que se te de mejor, si prefieres personajes, empieza por los personajes, lo que te anime a seguir creando y escribiendo.

  2. bueno brosther muchas pero muchas gracias… tengo una idea una gran idea dentro de mi cabeza quiero escribir y no para enviar este escrito a una editorial o no se a donde…… solo me gustaria que lo lea la persona a quien me gustaria que sepa que la tomé como mi inspiracion no se si esto funcione pero lo tuyo si me ayudo de mucho… agregame a tu correo me gustaria ke sigas aportando con mas ideas aun estoy verde y pues para mi eres grande chaval… muchas gracias otra vez y pues aver ke sale no?? no tengo ni idea de como se escribe una novela jajajajaja pero voy a intentarlo aver ke tal me sale graciaaaaaaaaaassss…:)

  3. eh bien… bueno si esta leyendo este comentario?? es para pedirle disculpas o sea kien sea ke lo lea si algun di lo leen pero el hecho es para usted… es mujer verdad?? yo pensaba ke era hombre de todos modos muchas gracias y otra vez disculpe las molestias lo siento adios,…

  4. Hola. Me paso por la caja de comentarios para dejar el mío porque necesito felicitarte por tus consejos. Ahora que mi mierdinovela lleva más de 200 páginas va a ser un poco difícil hacerla bien, ya que me he dado cuenta de que mis personajes no siguen demasiado el esquema y probablemente no tengan mucho enganche. Pero aun así, tengo más ideas y no dudaría en seguir tus consejos para llevarlas a cabo en un futuro. Muchísimas gracias.

    A menudo me quedo trabada y dejo de escribir por días, o incluso meses, pero como tú dices, ello me ayuda a ver lo último que he escrito con otros ojos y corregir lo que esté mal.
    Siempre me he obcecado mucho sobre las faltas de ortografía y gramática, dejando de lado aspectos importantísimos como el argumento o los personajes. Me gusta desarrollarlos y que evolucionen a lo largo de la historia, pero se me hace cuesta arriba.

    Lo que me motiva es que aún soy joven, y que aunque a mis quince tengo mucho por mejorar, también tengo mucho tiempo por delante para aprender.
    Gracias otra vez, y lo siento si he sido demasiado pesada con ese comentario. A veces me paso… xD

    Saludos.

    1. ¡Hola! Gracias por comentar, siento responder algo tarde 🙂
      Mis esquemas no son absolutos, no tengas miedo si no tus personajes no los siguen bien. Son herramientas de ayuda, principalmente.
      A mí la gramática y la ortografía me frustra porque no importa la atención que pongas y las veces que corrijas, aparecerán fallos xD. Así que intento relajarme un poco al respecto cuando hago el primer manuscrito y corrijo los errores en revisiones posteriores.
      No importa lo joven o mayor que se sea, siempre hay que trabajar para aprender y escribir mejor cada vez.
      No eres en absoluto pesada, me alegra que mi blog pueda ayudarte 🙂

  5. Vel anima : Cordial saludo. He leído algunos de tus comentarios de tu pagina, me parecen geniales. Acudo a ti por una ayuda, escribí una novela, pero tengo dificultad con el tiempo histórico y el tiempo estandar, como aplicarlo, igual con el caracter de los personajes y como hacer una correción.

¡Deja un comentario!