Preparando el NaNoWriMo 2013

Ya he hecho entradas sobre este blog sobre cómo superar con éxito el NaNoWriMo, pero no he mencionado cómo prepararlo más que de pasada y, como mencioné en una entrada anterior, este año intentaré prepararlo con tiempo y compartir parte del proceso, porque creo que así es más divertido y puede que más gente se anime a participar y sufrir conmigo :D.

Primero: algunos asuntos materiales

No pasa nada si ya tenéis una idea sobre vuestra novela (o cualquier otro trabajo no-novelesco si sois unos rebeldes), pero voy a empezar en estas entradas bajo el supuesto de que no y, bajo el supuesto de que no, creo que lo más importante que hace falta ahora es algo donde tomar notas de vuestras brillantes ideas.

Yo suelo usar esto para la muchos de mis trabajos:

Básicamente son folios blancos doblados y unidos con hilo, en este caso lana fina.

¿Cutre? Sí, mucho. La razón es que, sencillamente, cuando me vengan ideas a la cabeza puedo apuntarlas en cualquier papel que tenga a mano, hacerle un par de agujeros y juntarlo con sus hermanos. También ocupa menos espacio que una carpeta con anillas, por si quiero llevarlo dentro de un libro, o similar, y tomar notas en el tren, trabajo, sobre una rodilla… Además, soy rácana y así reciclo.

De vez en cuando, también da por ser un poco menos cutre y me gasto dinero en cosas, como esta libretita tan cuca: Seguir leyendo «Preparando el NaNoWriMo 2013»

NaNoWriMo 2011: Últimos consejos para ganar

Luchar contra el bloqueo

Hay gente que funciona bien planificándolo todo al detalle, hay quien se lanza a la aventura y escribe lo que le surja en el momento. No importa cómo nos enfrentemos al NaNo, lo importante es que no nos atasquemos. Para evitarlo, es buena idea practicar antes; medir la velocidad a la que escribimos y cómo  reaccionamos ante los bloqueos para buscar una estrategia adecuada a nosotros (planificación,  espontaneidad, etc.).

Organizar el tiempo

Al practicar, además, mediremos el total que tardamos en escribir 2000 palabras (bloqueos incluidos), con este tiempo podemos calcular el tiempo mínimo diario que necesitaremos para ganar el concurso. El mínimo diario en realidad es de 1667 palabras, pero es mejor tener un colchón por si acaso (como un mínimo de 2000 al día).

Otro factor que conviene considerar es que al principio probablemente lo cogeréis con mas ganas, mientras que os comenzará a pesar a medida que pasen los días, por ello yo recomiendo pegaros un empacho a escribir los primeros días, para coger ventaja, a la porra la planificación y dormir; escribid, escribid y escribid cuanto podáis.

Además, calculad también aquellos días que puede que no tengáis mucho o ningún tiempo para escribir, prevedlo para no encontraros que os pilla el toro. Si habitualmente los viernes a la noche llegáis demasiado cansados del trabajo, no contéis ese día en vuestros planes con que vais a hacer un esfuerzo para escribir, y menos en los últimos días y sin inspiración, descansad tranquilos y pensad con antelación en cómo recuperar otro día.

Trucos más desharrapados

  • Para no perder el tiempo inventando/buscando nombres, o cualquier otra referencia, usar “PERSONAJE 1”, “LABORATORIO X”, “CONTAR UN CHISTE SOBRE BORRACHOS AQUÍ” como sustituto sirve.
  • Hacer largas descripciones de objetos, personas o paisajes. Sacar directamente información de un paraje de una enciclopedia, aunque no sea de utilidad en la historia, sirvió a Dan Brown, puede servir a un Wrimo.
  • Recordad: en caso de duda zombies, ninjas, piratas y/o vampiros.
  • Matar personajes sin avisar es casi tan popular como los zombies.
  • Dar nombres muy largos a los personajes y lugares, escribirlos completos cada vez utilizando herramientas de Ctrl+C ó las de “Buscar y sustituir” en Word.
  • Usar citas de modo habitual, haciendo que los personajes lean grandes trozos de otras novelas, repasar recetas o la lista de la compra, también que sufran arrebatos y les de por recitar poesía o cantar canciones. Es el «estilo Tolkien».
  • Poner largos títulos de capítulos cada pocos párrafos.
  • Hacer que los personajes se enfrasquen en espesas meditaciones filosóficas, o incluir opiniones sobre si las ballenas son peces o mamíferos. En Moby Dick funcionó.

Y lo más importante…

NO CORREGIR NI EDITAR

(a no ser que vayáis muy sobrados y sean cosas mínimas)


Guía Rápida para Escribir una Novela

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma al primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :).

 

Cómo escribir novelas sin dinero: El Estilo 2

Continuando con mi maravillosa saga sobre cómo aprender a escribir novelas aprovechándome gratis de los recursos de la red y divagando como si no hubiera mañana (y, a veces, hasta las escribo). Aquí están las entradas anteriores.

En esta continuo un poco con el tema del estilo. En la primera entrada hablé del estilo en general, referido a la claridad de la narración, la organización, el orden de las ideas y las plabras para dar mayor expresividad y fuerza a la historia, etc.

Ahora me voy a meter un poco con detalles más concretos, como son las frases y las palabras en sí mismas.

Clichés no, gracias, debes dejarlos crecer

A menudo el cliché se emplea para referirse a técnicas o argumentos usados hasta el punto del abuso. Lo malo de los clichés no es que lo que ocurre está mal, si no que se ha hecho tantas veces que es predecible y aburrido.

Por otro lado, he aprendido que en el estilo los clichés también son frases hechas o expresiones repetitivas, que en el mundo normal se emplean mucho (y probablemente, hasta en cientos de libros que hayamos leído), pero que cuando queremos escribir una novela debemos evitar. ¿Por qué? Pues porque como en los clichés argumentales, carecen de fuerza e interés, no atrapan al lector (que es el principal objetivo de un novelista que quiera pa’ comé). A veces hasta son ridículos.

Seguir leyendo «Cómo escribir novelas sin dinero: El Estilo 2»

¡WEBCOMIC! (yep, I went there)

Después de pensarlo mucho, trabajar varias ideas y palntearme a conciencia lo que espero sea un proyecto a largo plazo, os presento, con ilusión y miedo* MI NUEVO WEBCOMIC:

*tendría más ilusión y miedo si no estaría acatarrada, ahora mismo sólo siento dolor de cabeza.

Nombre: No Hay Príncipes

Género: Fantasía, Slice of Life, de aventuras y humor e igual cae algo de romance. (science-fiction cross with chicklit cross with literary fiction).

La idea inicial es actualizar una página por semana, alguna más al principio, para coger carrerilla, y si me organizo bien quizá suba a dos a la semana. Planeo que dure un año, quiero centrarme en trabajar a largo plazo en esto, quiero trabajar mi habilidad como dibujante y narradora dentro de unos parámetros más o menos constantes, al finalizar lo que tengo pensado para este año ya veré cómo decido dejarlo, si lo dejo (otra cosa no sabré hacer, pero parir ideas, pffffff).

La historia en sí la he trabajado especialmente para poder tocar varios palos y esforzarme en desarrollar diferentes personajes y entornos, pero espero que sea entretenida y fácil de seguir.

Os dejo aquí tres páginas en «beta» de muestra, espero tener una página web operativa para finales de semana. Estoy pensando en una página en LiveJournal porque las opciones para alterar otros blogs de forma gratuita son bastante incómodas para webcómics y ahora mismo no tengo dinero.

Seguir leyendo «¡WEBCOMIC! (yep, I went there)»

Ogam: Sail

Cuarta entrada dedicada a la serie sobre el ogam/ogham y penúltima de esta feda. Tenía las que quedaban hechas de hace tiempo, pero entre pitos y flautas olvidaba subirlas.

Ogam
Ogam

Significado de Sail según mi PG:

Las corrientes van y vienen, el tiempo pasa, las estaciones van y vienen, el tiempo pasa, las hojas caen y renacen, el tiempo pasa. Las caras de los ancestros aparecen en la corteza del árbol.

Para ver las entradas anteriores de la serie.

El Secreto de los Dientes de León

[Última entrada :D. Pronto una entrada recopilación]

El Secreto de los Dientes de León

Capítulo 16

Dejó que su amiga la arrastrara hasta el atajo. Sus ojos tuvieron que enfocarse de nuevo a la oscuridad del camino de tierra y la vegetación que los cubría, sintió fuertes punzadas en la cabeza que tardaron en remitir. Prácticamente no veía por donde andaba, su atención estaba lejos de allí, la propia debilidad que sentía le impedía darse cuenta de lo enferma que se encontraba. Pasado un tiempo, se recobró lo suficiente como para pensar con seriedad en abandonar ella también, no sabía lo que le estaba pasando, posiblemente solo fuera víctima de un terrible cansancio, pero temía acabarse desmayando en el momento más inoportuno.

Seguir leyendo «El Secreto de los Dientes de León»