Hacer mapas para mundos imaginarios: escala

Quería hacer alguna entrada sobre cómo hacer mapas para novelas de fantasía (o de rol si sois de esos~), pero empecé a escribir y se me fue de las manos, así que voy a hacer entradas más pequeñas (lol) y dedicarlas a un solo punto cada vez. Hacer planos/mapas es otro de esos asuntos sobre las que tengo algunos estudios de los güenos y, paradójicamente, no suelo hacer, aunque sé de muchos fans de la fantasía y el rol cuya una de sus aficiones favoritas es precisamente crear mapas, cosas de cuchillos de palo en casas de herreros, supongo 😀

Así que la entrada de hoy va sobre la escala.

Qué es la escala

La escala es un elemento que nos traduce las distancias que aparecen sobre la hoja de papel de nuestro plano en distancias en un espacio real. Habitualmente se da en unidades de medida como metros, kilómetros, millas… o los equivalentes fantásticos que os apetezcan; pero también pueden tener un componente de tiempo: días que tarda una persona de llegar de un punto a otro, por ejemplo.

Esto último es una escala bastante dinámica y útil que yo suelo usar mucho, ya que en una historia donde los personajes se mueven el espacio, qué medida hay de un punto a otro me dice menos, de cara a plantear la historia, que cuánto tardan en llegar.

Tamaño del mapa

Dependerá completamente de la historia que querréis hacer, especialmente si ya tenéis una idea de dónde se va a situar gran parte de la acción. Si ocurre casi todo en una ciudad con un plano de la ciudad vais sobrados, si es una gran épica en la que aparecen decenas de países necesitaréis una escala mayor. Tener esto en cuenta al principio es importante porque condiciona el tipo de escala, dónde se va a ver el mapa (son notas personales como referencia, para subir a la web, un libro de bolsillo…), el tipo de mapa representado (de detalle, genérico…), etc.

También sé que algunos empiezan directamente con el mapa antes de tener una historia clara, en este caso no hay mucho que pensar, solo ponerse a garabatear en el papel y ver lo que sale, lo que es un fantástico ejercicio de creatividad.

Representación

En cuestiones de fantasía, como una gran parte está inspirada en mapas antiguos (o en la inspiración de la inspiración de mapas antiguos), muchos no solo no tenían escala si no que de existir eran más bien como una sugerencia, de hecho, representar los elementos del plano más importantes de mayor tamaño y los menos de menor ( o hacerlos desaparecer) sin atender a nada parecido a escalas, o lógica espacial en absoluto, era una convención muy habitual. En principio no es obligatorio representarla si hacéis un mapa de este estilo, pero si estáis usando el mapa como referencia personal en el desarrollo de una novela/juego, igual os conviene tomar nota de ello en alguna parte para tenerlo en cuenta y que el desarrollo sea aun poco más sólido y realista. Las representaciones más habituales son:

  • Numérica: es bastante técnica y no sé si queda del todo bien en una obra de fantasía medieval, por ejemplo, pero igual sí en una de steampunk. Suelen ser tipo: 1:50000 (donde 1 cm dibujo son 50000 cm en la realidad), ó 1/200000 (donde 1 mm en el dibujo son 200000 mm en la realidad).
  • Gráfica: suelen ser como las barras de abajo, a veces también se dibujan reglas como las de andar por casa. Pueden quedar bastante bien en muchos mapas, especialmente si os da por ser creativos con ellas. Parte de un concepto simple en el que la longitud de la barra representa determinada unidad de distancia, aunque pueden complicarse un poco más al gusto.escala_moderna escala_sXVII

Material

Para un primer esbozo, o si es solo material de referencia, o un ejercicio de creatividad; yo uso papel cuadriculado porque ya te viene con escala «por defecto». Atendiendo al tamaño de mapa que hemos elegido arriba, le damos a cada lado del cuadrito una unidad de medida/tiempo (ventaja extra: los cuadrados nos servirán para calcular áreas con más facilidad, trazar direcciones, líneas de longitud/latitud, etc.).

Por ejemplo, como en Las Montañas de Sangre la mayoría de los personajes jinetes, en el mapa original decidí que cada cuadro representaba una media aproximada de cuánto era capaz de avanzar un jinete a paso normal en un día montando ocho horas en una superficie moderadamente plana (obviamente es difícil dar un número exacto ya que hay muchas cosas que pueden hacer variar esta distancia, como accidentes del terreno, horas de luz, las prisas del jinete, el estado del caballo, etc.; pero me pareció una aproximación más útil que darle una distancia y luego hacer cálculos para los días, que es con lo que trabajo de verdad en el desarrollo de la historia).

Recomiendo también, si vuestra intención con este mapa es pasarlo a limpio y que quede bonito, trazar las lineas de un color muy diferente a las hojas y las líneas de cuadricula, os ahorraréis problemas a la hora de calcarlo/escanearlo para eliminar las líneas, por eso es mejor no usar hojas que tengan las líneas negras, ya que el negro se superpone a casi todos los colores y materiales y son un dolor de muelas de distinguir del resto del mapa. Azul claro u ocre es lo mejor.

He puesto la escala como primera entrada a la hora de hacer un mapa porque incluye tener en cuenta conceptos básicos que más tarde podrían complicaros que  nuestro plano quede claro y resulte práctico (como que no se vean bien los elementos del mapa porque la hoja que habéis elegido es muy pequeña, o queden emborronados los unos con los otros). En caso de duda, empezad primero un mapa básico a gran escala, si creéis que la historia demanda más detalle, se puede hacer más tarde otro a una escala menor, y siempre tenéis el de escala mayor como referencia; da menos problemas que empezar uno a escala pequeña y daros cuenta luego que no encajan bien todos los elementos.

Bride Stories

Hablando de algo que no sea yo para variar (jar jar). Me he comprado el manga Bride Stories (Norma) porque lo conocía de hace tiempo y es la cosa más bonita del mundo mundial.

Voy a dejaros aquí unos vídeos que muestran parte del trabajo de la autora Kaoru Mori:

httpv://youtu.be/wfENoePp36o

Y como mi ordeñador entra en crisis y muere cuando hay más de dos vídeos en cualquier pantalla (y con uno ya le empiezan a dar mareos), os dejo el resto de esta serie de vídeos que muestran el magnífico trabajo de la mangaka terminando su dibujo en los siguientes enlaces:

Y ahora, si me disculpáis, voy a meterme debajo de mi mesa con un brick de Don Simón y llorar durante varias horas.

itssobeautiful

¿Qué es Flattr y cómo funciona?

Flattr es un servicio para donar dinero de forma simple a los artistas, o creativos en general, que nos gusten, de forma muy simple.

Botón de Flattr
Botón de Flattr

Si alguien se ha fijado, tengo estos botoncitos verdes por el blog desde hace algunos días para ir probándolo, así que voy a hacer un pequeño inciso en mi NaNoWriMo para explicar un poco en qué consiste y animar a la gente a usarlo, porque me parece una iniciativa muy interesante tanto para los que creamos contenido como para los que adoramos a otros creadores 🙂

Para empezar, en Fattrl te puedes registrar de dos formas:

  • Como creador (Creator): donde eres tú el que crea contenidos y quiere ganar dinero con el servicio. Como creador de contenidos puedes ser desde dibujante, a diseñador de páginas web, bloguero, youtubero, etc. Hay varias categorías y opciones dentro de la página web de Flattr.
  • Como seguidor (Supporter): donde apoyas a otros para que sigan creando donando pequeñas cantidades de dinero cada vez que pulsas en el botón de Flattr, o en sus favoritos, o en «me gusta», etc. Porque Flattr permite reconocer varios servicios.

En realidad, no hay mucha diferencia entre registrarse de una cosa u otra, la mayoría de la gente interesada tenemos un poco de creadores y seguidores de alguien al mismo tiempo.

Respecto al dinero es bastante simple: eliges una cantidad que quieras donar al mes, que puede ser tan baja como 2 euros (creo que incluso permite menos, aunque hay un fijo). De esos dos euros, todos los meses se dividirá a partes iguales un porcentaje entre las Cosas (Thing)  a las que hayas hecho flattr ese mes, y eso es lo que los creadores reciben.

Las Cosas son elementos individuales, como una entrada de blog, un tuit (sí, se puede donar por tuiter también, si queremos), un vídeo, una página de webcómic, una foto, etc. Es decir, no necesariamente donamos a los creadores en general, si no que podemos donar directamente a sus creaciones que más nos gusten.

Para hacer flattr, como he dicho, lo único que hace falta es pinchar en los botones del servicio (o los servicios que tengamos activados). Te dirigen a una página en la que te informan de que has hecho flattr y ya está. No tienes que introducir ningún tipo de información bancaria, no tienes que ir a Paypal, no tienes que meter tu contraseña o datos en ningún sitio salvo la primera vez cuando te decidas registrarte como seguidor (o la segunda o tercera, si prefieres ir poniendo mes a mes la cantidad que quieres pagar, permite varias opciones al respecto).

En principio, las donaciones pueden parecer muy pequeñas (microdonaciones), pero precisamente ahí puede residir el encanto de este tipo de sistemas, si cada vez que marcamos una estrellita o un «nos gusta» solo algunas entradas del blog que nos hemos encontrado por casualidad (por ejemplo, este mismo blog :D), podemos indicar a los autores cuál es su mejor contenido, apoyarles y sin gastar mucho dinero en merchandising o materiales que quizá no nos interesen tanto o, incluso, que no pueda vender ya que sus creaciones no se adaptan bien a esas plataformas (como desarrolladores, personajes del youtube, etc). También podemos apoyar a varios autores al mismo tiempo cada mes, aunque no tengamos mucha pasta para gastarnos dinero en todos ellos. Es más versátil que el botón de donaciones convencional y permite apoyar a los creadores de forma más directa y sencilla.

Y si luego queremos comprarnos su art-book a color de doscientas páginas, pos nos lo compramos también. Que mola mazo.

Si hay que ponerle alguna pega al sistema, es que, del total de dinero que se dona, un 10% va a la plataforma de Flattr, que con cantidades pequeñas como las que está basada el servicio no es mucho, aunque para cantidades mayores pica un poco más.

PD: por curiosidad, yo me enteré de la existencia de Flattr en el blog de la autora Jenny Trout mientras leía sus resúmenes de 50 Sombras de Grey. No hay mal que por bien, no venga, supongo xD

NaNoWriMo 2013: ¡COSILLAS!

En mi última entrada sobre cómo preparar el NaNoWriMo ¡traigo cosillas!

  • Para empezar, la Ficha en Excell para la novela, que ya la había subido antes, pero la dejo por aquí también. Contiene:
    • un contador de palabras bastante detallado con una gráfica,
    • una ficha para el resumen de la historia,
    • otra para los aspectos básicos de la misma (conflictos, personajes) y
    • una ficha de personaje (todas las pestañas se pueden copiar si necesitáis más, lo digo para los que no estáis familiarizados con el excell).
  • Luego, me he hecho este calendario que pondré de fondo de escritorio, es bastante sencillo para que cada cual lo personalice como quiera, solo tiene algunos pequeños apuntes, lo subo por aquí por si a alguien le sirve para programar su NaNoWriMo.

noviembre2013

  • Si os atascáis porque no se os ocurren nombres, tomad un generador de nombres aleatorio. Y a seguir escribiendo.
  • Os dejo también este meme: Author Dog [inglés], es gracioso (de una manera bastante dolorosa) y suele subir también recursos interesantes para escritores =P
  • ¿Queréis estar concentrados en lo que escribís y no distraeros con el navegador o cualquier otra chorrada? Podéis descargaros este programa, es un editor de texto extremadamente sencillo que incluso tiene la opción de poner un objetivo de palabras a alcanzar.
  •  Para más cosillas, tengo entradas previas sobre recursos diversos para escritores.
  • También os dejo mi tuiter: Ayrtha, porque iré haciendo comentarios sobre cómo me va en el NaNo (básicamente un montón de «¿POR QUÉ? ¿POR QUÉEEEE?»). Cualquiera está invitado a desesperarse conmigo 😀
  • Y, para la gente religiosa, os dejo esta encantadora imagen de la Musa Calíope y la Santa Trinidad. Llevadla como estampita en la cartera para inspiraros 🙂

calliope

Algunos recursos más

Otro interesante recurso para escritores, la Fundación del Español Urgente, con su cuenta en twitter, donde podéis enviarles dudas.

Voy a destacar este artículo sobre estilo que me gustó mucho: Cómo enfrentarse a la edición de textos. Tanto la fundación como este artículo están orientados a la publicación en medios y en internet, pero me parecen consejos muy útiles también en ficción.

Para hacer consultas otra página imprescindible es el Diccionario Panhispánico de Dudas, que me sorprende un poco que no haya mencionado anteriormente.

 

Guía Rápida para Escribir una Novela

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma al primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :).

 

Cómo escribir novelas sin dinero: El Estilo 2

Continuando con mi maravillosa saga sobre cómo aprender a escribir novelas aprovechándome gratis de los recursos de la red y divagando como si no hubiera mañana (y, a veces, hasta las escribo). Aquí están las entradas anteriores.

En esta continuo un poco con el tema del estilo. En la primera entrada hablé del estilo en general, referido a la claridad de la narración, la organización, el orden de las ideas y las plabras para dar mayor expresividad y fuerza a la historia, etc.

Ahora me voy a meter un poco con detalles más concretos, como son las frases y las palabras en sí mismas.

Clichés no, gracias, debes dejarlos crecer

A menudo el cliché se emplea para referirse a técnicas o argumentos usados hasta el punto del abuso. Lo malo de los clichés no es que lo que ocurre está mal, si no que se ha hecho tantas veces que es predecible y aburrido.

Por otro lado, he aprendido que en el estilo los clichés también son frases hechas o expresiones repetitivas, que en el mundo normal se emplean mucho (y probablemente, hasta en cientos de libros que hayamos leído), pero que cuando queremos escribir una novela debemos evitar. ¿Por qué? Pues porque como en los clichés argumentales, carecen de fuerza e interés, no atrapan al lector (que es el principal objetivo de un novelista que quiera pa’ comé). A veces hasta son ridículos.

Seguir leyendo «Cómo escribir novelas sin dinero: El Estilo 2»