NaNoWriMo 2013: los Metadatos

[Enlace para tener juntas todas las entradas sobre cómo preparar el NaNoWriMo.]

 

Tercero: los Metadatos

Los metadatos son los datos básicos de la obra: título, género, autor, número de páginas, etc., sin entrar en la historia (aquí hay una definición más larga).

Como ya tenemos una idea de nuestra historia, vamos a rellenar algunos de estos metadatos, no todos porque obviamente el número de páginas no vamos a saber, pero creo que empezar por esta información es clave para centrar nuestra obra:

Título

Vamos a elegir un Título para la obra, así de primeras, no penséis mucho cuál podría ser el mejor, si no lo tenéis aún. La razón es que creo que dar un Título le confiere más identidad a la historia, aunque sea un Título provisional, es algo tan concreto sobre lo que se puede trabajar, es la diferencia entre tener una idea en la cabeza y tener una nueva obra entre tus manos. Es posible que, a medida que nuestra historia avance, el Título no nos convenza, por la razón que sea, y no pasa nada por cambiarlo. Así que, aunque no estéis muy seguros, ponerle un título, ahora.

Género

El Género se refiere a si es fantasía, ci-fi, policíaca, romance, etc. También si es de aventuras, épica, comedia… Elegir el Género de nuestra historia ayudará a concretar muchos de los límites y libertades de la misma, por ejemplo, si elegimos una comedia romántica sería un poco absurdo que aparecieran piratas interestelares de la nada, entonces saltaría a la fantasía y/o ci-fi, sin embargo, en una comedia romática podemos escribir páginas y páginas de fluff y moñerías, que no quedarían demasiado bien en una novela de aventuras espaciales (aunque algo de moñería ocasional tampoco hace daño).

Y si va a haber comedia, habrá que pensarse los chistes, porque no hay nada más cutre que leer una novela donde un personaje se supone que es gracioso y es más rancio que el pan de un mes. Esos aspectos hay que pensarlos y trabajarlos, lo cual va a ser muy difícil durante el NaNo, así que considerad con antelación cómo vais a enfrentaros a estos temas (podéis poner “CHISTE GRACIOSO AQUÍ” si no se os ocurre nada y rellenarlo más tarde).

A menudo, los Géneros tienen también sus propios tópicos y clichés sobre los que podemos construir la historia si nos quedamos sin ideas en algún momento del NaNo (voy a recordar que la idea del NaNoWriMo son escribir 50.000 palabras en un mes, no lograr el próximo premio Nóbel de la literatura), podemos elegir nuestro tópico favorito o destrozar uno al que le tengamos manía y ya tenemos más páginas por rellenar.

Tema

El tema suele ser el concepto de fondo que hace que una novela con todas sus tramas y sub-tramas sea relativamente coherente. También puede entender como el Objetivo, no de los personajes, si no del autor. A menudo, el Tema cae en la ‹‹propaganda››, en el sentido de que el autor ha usado el libro para presentar su punto de vista sobre cierto asunto, esto no es necesariamente malo, a no ser que sea estúpido, de hecho, diría que es casi imposible narrar una historia sin posicionarse en uno u otro tipo de ideología.

El Tema a menudo resulta simplemente: ‹‹analizamos el sentido de la vida››, ‹‹la justicia››, ‹‹la transición entre la infancia a la madurez››, ‹‹la afectación de políticas liberales en campos de trigo inspirados en el medievo europeo››, etc.

Aparte del Tema Principal, también podemos tener sub-temas relacionados, o no, donde poder seguir rellenando páginas, y, aún así, ser capaces de mantener un nexo común a toda la historia para no perdernos e irnos por las ramas (aunque irse por las ramas en el NaNoWriMo no es necesariamente malo, es malo si luego tienes intención de crear una novela leíble por otros que no sean tú y tu madre).

A mí el Tema siempre es algo que me lleva por el camino de la amargura, ya que nunca pienso en ello antes de hacer mi historia y luego siempre tengo problemas para definirlo. Hay pedantes que exigen que toda buena historia tenga un tema concreto, yo no creo que sea necesario, pero sí es importante tener una idea consciente del fondo de la historia que queremos contar. En general, el tema no debería ocupar más de una o dos líneas, no es un resumen ni una reseña de la historia.

Como en otras entradas, aquí van mis metadatos:

  • Título: La Última Caminante
  • Género (s): Fantasía, juvenil, aventuras, drama
  • Tema (s): las responsabilidades (principal), el pasado, el equilibrio cósmico…

La idea de decidirnos por unos metadatos ahora (podemos cambiarlos o ampliarlos más adelante, no os es cuestión de estresarse por ellos tampoco), se debe a que cuanto antes tengamos una definición de lo que queremos hacer, más fácil nos resultará rellenar los huecos en adelante. Parece un poco contraproducente, en un reto como el NaNoWriMo poner límites a nuestra historia tan pronto, pero, en mi experiencia, los límites a menudo ayudan más con la inspiración que ver una simple hoja en blanco.

Para ir adelantádoos a mis entradas, si queréis, aquí tenéis una recopilación de entradas que hice hace un par de años sobre cómo ganar el NaNoWriMo.

NaNoWriMo 2011: Últimos consejos para ganar

Luchar contra el bloqueo

Hay gente que funciona bien planificándolo todo al detalle, hay quien se lanza a la aventura y escribe lo que le surja en el momento. No importa cómo nos enfrentemos al NaNo, lo importante es que no nos atasquemos. Para evitarlo, es buena idea practicar antes; medir la velocidad a la que escribimos y cómo  reaccionamos ante los bloqueos para buscar una estrategia adecuada a nosotros (planificación,  espontaneidad, etc.).

Organizar el tiempo

Al practicar, además, mediremos el total que tardamos en escribir 2000 palabras (bloqueos incluidos), con este tiempo podemos calcular el tiempo mínimo diario que necesitaremos para ganar el concurso. El mínimo diario en realidad es de 1667 palabras, pero es mejor tener un colchón por si acaso (como un mínimo de 2000 al día).

Otro factor que conviene considerar es que al principio probablemente lo cogeréis con mas ganas, mientras que os comenzará a pesar a medida que pasen los días, por ello yo recomiendo pegaros un empacho a escribir los primeros días, para coger ventaja, a la porra la planificación y dormir; escribid, escribid y escribid cuanto podáis.

Además, calculad también aquellos días que puede que no tengáis mucho o ningún tiempo para escribir, prevedlo para no encontraros que os pilla el toro. Si habitualmente los viernes a la noche llegáis demasiado cansados del trabajo, no contéis ese día en vuestros planes con que vais a hacer un esfuerzo para escribir, y menos en los últimos días y sin inspiración, descansad tranquilos y pensad con antelación en cómo recuperar otro día.

Trucos más desharrapados

  • Para no perder el tiempo inventando/buscando nombres, o cualquier otra referencia, usar “PERSONAJE 1”, “LABORATORIO X”, “CONTAR UN CHISTE SOBRE BORRACHOS AQUÍ” como sustituto sirve.
  • Hacer largas descripciones de objetos, personas o paisajes. Sacar directamente información de un paraje de una enciclopedia, aunque no sea de utilidad en la historia, sirvió a Dan Brown, puede servir a un Wrimo.
  • Recordad: en caso de duda zombies, ninjas, piratas y/o vampiros.
  • Matar personajes sin avisar es casi tan popular como los zombies.
  • Dar nombres muy largos a los personajes y lugares, escribirlos completos cada vez utilizando herramientas de Ctrl+C ó las de “Buscar y sustituir” en Word.
  • Usar citas de modo habitual, haciendo que los personajes lean grandes trozos de otras novelas, repasar recetas o la lista de la compra, también que sufran arrebatos y les de por recitar poesía o cantar canciones. Es el «estilo Tolkien».
  • Poner largos títulos de capítulos cada pocos párrafos.
  • Hacer que los personajes se enfrasquen en espesas meditaciones filosóficas, o incluir opiniones sobre si las ballenas son peces o mamíferos. En Moby Dick funcionó.

Y lo más importante…

NO CORREGIR NI EDITAR

(a no ser que vayáis muy sobrados y sean cosas mínimas)


NaNoWriMo 2011: Fichas de personajes

Para ganar el NaNoWriMo, crear personajes como un niño come caramelos es la forma más fácil de rellenar páginas y paginas y paginas, cada personaje tiene una descripción, una historia, un objetivo, un desenlace, etc. Se pueden hacer grandes épicas en base a un solo personaje. El problema es, que hay que crearlos, pero con una buena idea de los personajes que queremos y cómo los queremos en base a nuestra historia, no debería ser tan difícil, ¿verdad?

Fichas de personaje

En una entrada anterior ya hable de cómo crear personajes y un truco de mi propia cosecha para darles mas profundidad que el que ofrecen las típicas Fichas de Personaje, planteándonos el mismo en tres capas como mínimo.

Vale, para el NaNo olvidad la mitad de cosas que dije entonces. Haced una ficha para vuestros personajes, cuantos más datos absurdos mejor, cada pequeño detalle de su vida no nos da necesariamente una visión más profunda del mismo, pero es un relleno más que aceptable en el NaNo.

Os ofrezco un ejemplo de ficha de personaje:

Información general:

Nombre:       Apodo:

Edad:     Sexo/Género:  Raza/Etnicidad:

Nacionalidad:

Objetivos (en la historia):       Papel(su función básica en la historia):

Transfondo:

Estudios:   Familia:

Trabajos/Oficios:   Amigos:

Residencia:   Aficiones:

Habilidades:   Orígenes:

Físico:

Pelo:   Ojos:

Piel:   Constitución:

Altura:   Voz/Acentos:

Rasgos característicos:   Enfermedades/Trastornos:

Psíquico:

Personalidad aparente:   Personalidad oculta:

Carácter:   Vicios/Manías:

Fortalezas:   Moral:

Rasgos característicos:   Enfermedades/Trastornos:

Relleno:

(Bueno, puede que algunos de estos datos no sean relleno si no parte importante de su carácter/la trama)

Estilo de ropa más habitual, comida favorita, ¿fuma/bebe?, primera pareja (si tuvo) ¿quién fue y por qué lo dejaron?, color favorito, de qué lado de la cama se levanta, qué hace antes de acostarse, zurdo/diestro, joyas/maquillaje/tatuajes, qué coche tiene, a quién quería parecerse cuando era peque, qué canciones escucha cuando se enfada o está triste, etc. Podéis poner lo que se os ocurra.

Rellenar la ficha

Obviamente, una vez tenemos la ficha, lo que nos toca hacer es rellenarla. ¿Como? Bueno,  si no tenéis una idea básica para los personajes que queréis, podéis usar cualquier método ya discutido en la primera entrada sobre las ideas. En caso de emergencias creo que lo mejor es coger un generador aleatorio (o papeles dentro de un bol) e ir rellenando los huecos según las cosas que salgan, acabaréis antes y, con la búsqueda al azar, puede que hasta encontréis ideas nuevas que no os habíais planteado.

Crear un elenco de personajes

Podéis plantearos una plantilla mínima de personajes para empezar:

  1. Protagonista
  2. Aliado del protagonista
  3. Antagonista
  4. Aliado del antagonista
  5. Fuente de información que ayuda al protagonista
  6. Fuente de desinformación que confunde al protagonista
  7. Comodín (este personaje puede encuadrarse en cualquier papel, puede hacer cualquier cosa que el autor quiera que haga, a menudo sirve para crear intriga con el lector porque nadie sabe si es de los buenos, de los malos, asuntos propios o pasaba por allí).

Esos son ya siete (7) personajes, así, de la nada, cada uno con su historia, sus rarezas, sus objetivos y sus páginas llenas de deliciosas letras para ganar el concurso. Podéis crear varios protagonistas (aunque en condiciones normales se considera que manejar muchos personajes principales es difícil, esto es NaNoWriMo, ¡intentadlo!), muchos aliados del antagonista principal, varios secundarios cotillas o bocazas que hablen mucho, un par de comodines por ahí para crear suspense…

 

A la hora de escribir vuestra novela para el NaNo, podéis empezar con los personajes o con la historia, haced una ficha rápida, con lo primero que se os pase por la cabeza, o un guión básico para la historia, cuando lo tengáis os daréis cuenta de cómo tanto los personajes como el argumento empezarán a moverse como con vida propia, solo necesitan una ayudita de vez en cuando para coger carrerilla. No os preocupéis por la coherencia, no os preocupéis por los agujeros en la trama, eso es para la edición en diciembre. En noviembre, solo existe el escribir.

Guía Rápida para Escribir una Novela

Sigue formando parte de mi serie sobre cómo escribir por internés, le he quitado el titulillo porque empezaba a aburrirme.

Este es otro esquema rápido de cómo escribir una novela, como creo que debería hacerse, al menos (no soy excesivamente buena con eso de planificar cosas, vamos a ver si escribiendo sobre ello me animo a hacerlo mejor). El anterior esquema trataba más sobre la novela en sí misma y cómo organizarla, esta vez voy a analizar un poco el proceso en su totalidad.

Antes de empezar: planteamientos previos

Aspirantes a escritores como yo, es decir, sin ser profesionales; solemos empezar a escribir cuando la Musa aparece y nos trae una idea (que escribiremos perfectamente bien a la primera, mandaremos a una editorial que la adorará y en dos semanas estaremos entre los Best Sellers, fijo). Sin embargo, la mayoría de los profesionales de la escritura tienen que presentar tal trabajo, sobre tal tema, en tal rígido formato (según me han contado, guionistas de series de televisión es de los peores sitios donde puede terminar un escritor).

Por eso, aunque el Punto Uno pueda ser «tener una idea», creo que es un buen ejercicio aprender a buscar las ideas. Incluso si tenemos ya casi todo nuestro glorioso argumento trazado, seguro que mientras escribimos nos encontramos con problemas y agujeros que necesitan de nuestro ingenio para ser vencidos. Cultivar activamente nuestra habilidad para tener ideas es importante. Buscaré ejercicios sobre como fomentar nuestra creatividad para futuras entradas.

Escribir una Novela: Paso a Paso

  1. Tener ideas: recogedlas, guardarlas, en cualquier sitio, en cualquier parte, cada una puede ser una nueva historia o juntarse en un sólo libro.
  2. Primer esbozo: normalmente la base de la que será la novela, es algo más evolucionado que la idea inicial y lo suficientemente sólido para empezar a escribir, pero probablemente el resultado final no se parecerá ni de broma al primer esbozo.
  3. Planificar el argumento: aquí hice ya una entrada con trucos para planificar un buen argumento. Este punto y el siguiente pueden (y deben) ser intercambiados y repetirse tantas veces como sea necesario para tener una historia sólida.
  4. Planificar los personajes: en esta otra entrada hablé un poco sobre crear personajes. Igual que con el punto anterior, a veces un cambio en el argumento hace necesario un cambio en algún personaje, y viceversa, argumento y personajes viven el uno del otro.
  5. Escribir: tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca
  6. Re-escribir: En medio de todos esos golpes de tecla os acabáis de dar cuenta que vuestro detallado y planificado argumento tiene un agujero por el que podría pasar una pirámide de elefantes borrachos. Este es el protocolo a usar en estos casos:
    • Parar.
    • Golpear vuestra frente contra el escritorio manteniendo un ángulo de 30º sobre la superficie.
    • Llorar lágrimas amargas de dolor y frustración.
    • Volved a los puntos 3 y 4 sobre Planificación y rehaced lo que haga falta.
    • Seguid escribiendo.
  7. Primer Manuscrito: Habéis terminado, coged aire, id a ver una película y leeros un par de libros buenos. Hay un 101% de probabilidades de que este primer manuscrito sea basura, pero no os preocupéis, ya habrá tiempo para el desánimo más tarde.
  8. Editar: Dependiendo a qué experto consultéis, os dirán diferentes métodos para pulir vuestra novela. El más habitual es sencillamente dejar olvidada la historia una larga temporada (de 15 días a  varios meses), así la podréis ver con nuevos ojos cuando llegue la hora de hacer las correcciones. Este es un esquema rápido de lo que debéis mirar en las correciones (Anne Mini [ing] tiene entradas épicas al respecto):
    • Argumento: ¿es sólido?, ¿es coherente?, ¿aporta algo nuevo y diferente respecto a lo que ya hay en el mercado?
    • Personajes: ¿tienen su propia voz?, ¿son atrayentes?, ¿llevan bien la trama?
    • Estilo: ¿está todo explicado con claridad?, ¿el lenguaje es sencillo pero preciso?, ¿es activo?, ¿está bien formateado?
    • Gramática/Ortografía: repasadlo veinte millones de veces. Contra lo que algunos creen, no es trabajo del editor corregirlo (y menos si no habéis sido publicados nunca), es el vuestro.
  9. Re-editar: Sí, otra vez y las veces que haga falta. Podéis dejársela a amigos o familiares (si os fiáis de ellos, dun dun DUN) para que os den nuevas perspectivas.
  10. Décimo Manuscrito/recabar información: es posible que este sea el momento de enviarlo a una editorial o un concurso (si es lo que queréis). Dejadlo e informaros bien de lo que la editorial/concurso pide (si no pide nada podéis informaros por teléfono o correo electrónico, a veces hasta responden), últimamente, gracias a los americanos, está de moda ir primero a por un agente. Haced un listado de editoriales/agentes/concursos, empezando de mayor a menor interés (evitad cosas como co-ediciones y movidas chungas de esas, no me parece buena idea pagar a otra gente por publicar nuestras historias, por muy tentador que sea tener un libro nuestro en las estanterías, pero esto igual es cosa mía).
  11. Re-edición La Venganza de Chuki: Repasad otra vez el manuscrito para aseguraros de que está presentable y es lo que os piden antes de enviarlo a ninguna parte.
  12. Enviadlo: No repaséis de nuevo vuestro manuscrito hasta una semana después de haberlo enviado, porque encontraréis errores, muchos, y querréis correr tras el cartero para que jamás llegue a su destino, pero será tarde… AJAJAJAJAJAJA. Vuestro consuelo es, si habéis editado más de 10 veces y tenido cuidado con las faltas de ortografía y el formato, probablemente vuestro manuscrito no será lo peor que el pobre infeliz que tengan leyendo estas cosas tendrá que echarse a la cara en todo el día (o en todo el mes).

A partir de aquí ya no tengo consejos porque yo tampoco tengo ni idea. Si se pasa alguien por aquí que haya sido publicado profesionalmente alguna vez le invito amablemente a restregárnoslo por la cara compartir su opinión :).

 

Esquema básico de una novela

*Addendum: Taller Literario para Pobres*

Me he hecho este gráfico que igual alguno quiere aprovechar, esta basado en lo escrito por Jim Butcher en este LiveJournal, aunque reinterpretado, reconfigurado y reescrito un poco a mi manera. Si tenéis dudas de lo que es cada punto podéis ir a mirar al blog original… o igual debería hacer una aclaración a pie de imagen no sé.

La idea surgió porque el sistema para escribir un libro que sugiere, me parece uno de los más claros y elementales que he visto. Quiero decir, este blog es una maravilla y me encanta, pero hay mucha información y a menudo es un dolor de muelas buscar un dato concreto. Y no sé a otros, pero cuando yo escribo tiendo a no ver el bosque por culpa de los árboles (o como se diga), la mitad de las veces no sé lo que estoy poniendo realmente y creo que mi cerebro de ingeniera funcionaría mejor con un esquema corto cerca, a modo de mapa, para reencontrarme a mí misma en medio de tanto dichoso árbol.

Básicamente, busque el método que me pareció más simple y lo simplifiqué todavía más. Lol, ingenieros.

Haced click para verlo en grande

Y pasando a otra cosa…

Análisis de lo que he hecho en el NaNoWriMo

Al final no he escrito ni de lejos como el año pasado, para empezar por culpa de la falta de tiempo (que es otra y lo que rondaré morena). Además, a diferencia del año pasado también, esta historia era muy diferente por dos asuntos importantes:

1ºNo tenía una buena idea de a dónde quería ir. En la anterior me inventaba cosas como si no hubiera mañana, pero tenía una idea relativamente clara de cómo quería llevar la historia y a dónde. No tanto este año.

2ºLa más importante, probablemente. La novela del año anterior es una historia de aventuras que quería que fuera sencillamente entretenida y divertida, con algo de drama aquí y allá, así que no le daba demasiadas vuelas a la cabeza a lo que iba a hacer, sólo me dejaba llevar. La de este año es bastante más seria, combinando acción con tripis mentales un tanto fuertes, probablemente hubiera necesitado más maduración para hacerlos bien, así que a menudo me quedaba bloqueda porque luchaba entre escribir algo ~~profundo~~, o sencillamente escribir y rezar para que alguna cosa tuviera sentido en medio de todas esas palabras.

Lección a aprender: Para el NaNoWriMo elegir cosas divertidas.

Y para mañana…

Empiezo el DiDePeDi (Diciembre De Dibujo Personal… admito sugerencias) y espero que alguien se anime. Voy a hacer un dibujo cada día (aunque sea un esbozo cutre), los subiré según ande de tiempo, pero prometo subirlos todos :D. Si alguien tiene algún tema sobre el que quiere que dibuje algo es libre de pedirlo.